Module 13
Read the input
Getting the sequence into your program.
Input
Your program needs a sequence to analyze. For now, you can define it as a variable. Later, you could read it from a FASTA file.
sequence = "ATGCGTAATGCGGGCCCAAA"
Getting the sequence into your program.
Your program needs a sequence to analyze. For now, you can define it as a variable. Later, you could read it from a FASTA file.
sequence = "ATGCGTAATGCGGGCCCAAA"